Hi, I took your program and compiled it. I provided it with a file lagan1.fasta (with content > test CAGCCGGATCGGGATCTATC The program works fine as you can see. It outputs positions 6 and 12. darwin10.0 : ./find_exact CAGCCGGATCGGGATCTATC GATC 6,12, Knut Von: Julio Cesar Carbajal <carbaj1@hotmail.com> Antworten an: SeqAn Development <seqan-dev@lists.fu-berlin.de> Datum: Fri, 11 Feb 2011 15:42:39 +0100 An: "Tobias R." <seqan-dev@lists.fu-berlin.de> Betreff: [Seqan-dev] Specific problem |
Attachment:
smime.p7s
Description: S/MIME cryptographic signature