FU Logo
  • Startseite
  • Kontakt
  • Impressum
  • Home
  • Listenauswahl
  • Anleitungen

Re: [Seqan-dev] Specific problem

<-- thread
<-- date
  • From: "Reinert, Knut" <Knut.Reinert@fu-berlin.de>
  • To: SeqAn Development <seqan-dev@lists.fu-berlin.de>
  • Date: Fri, 11 Feb 2011 15:57:07 +0100
  • Acceptlanguage: en-US, de-DE
  • Reply-to: SeqAn Development <seqan-dev@lists.fu-berlin.de>
  • Subject: Re: [Seqan-dev] Specific problem

Hi,

I took your program and compiled it. I provided it with a file lagan1.fasta (with content 

> test
CAGCCGGATCGGGATCTATC


The program works fine as you can see. It outputs positions 6 and 12.

 darwin10.0 : ./find_exact 
CAGCCGGATCGGGATCTATC


GATC
6,12,

Knut

Von: Julio Cesar Carbajal <carbaj1@hotmail.com>
Antworten an: SeqAn Development <seqan-dev@lists.fu-berlin.de>
Datum: Fri, 11 Feb 2011 15:42:39 +0100
An: "Tobias R." <seqan-dev@lists.fu-berlin.de>
Betreff: [Seqan-dev] Specific problem

Hello.

Forgive me.

I am using a external file such as lagan1.fasta (Escherichia coli) with demo program: find_exact.cpp.
During the running of the program, the program NO PRINT occurrences of needle in the haystack.

///
// the problem: NO PRINT the find position of my_needle within the my_haystack.
// How to solve this problem?

    while (find(finder, pattern))
    {
        ::std::cout << position(finder) << ",";
    }    
///
      
I am doing this, because it is my intention to measure the run time execution of Horspool algorithm,
with different size of my_needle for this situation.


Could you say me how to solve this problem.


Thanks.

Julio.

Attachment: smime.p7s
Description: S/MIME cryptographic signature

<-- thread
<-- date
  • References:
    • [Seqan-dev] Specific problem
      • From: Julio Cesar Carbajal <carbaj1@hotmail.com>
  • seqan-dev - February 2011 - Archives indexes sorted by:
    [ thread ] [ subject ] [ author ] [ date ]
  • Complete archive of the seqan-dev mailing list
  • More info on this list...

Hilfe

  • FAQ
  • Dienstbeschreibung
  • ZEDAT Beratung
  • postmaster@lists.fu-berlin.de

Service-Navigation

  • Startseite
  • Listenauswahl

Einrichtung Mailingliste

  • ZEDAT-Portal
  • Mailinglisten Portal