[Seqan-dev] How to extract alignment information from an Align object when doing a Smith-Waterman alignment?

[Tianyang Li 李天阳 Tommy Li <tmy1018@gmail.com>]

Hi,

I have a question about how to extract alignment information from an
Align object when doing Smith-Waterman alignment.

For example,

    #include <iostream>
    #include <seqan/align.h>
    #include <string>

    using namespace seqan;

    int main()
    {
    	Align< String<Dna> > ali;
    	::std::string s1 = "CGCGGGGCATATATTTTTTTA";
    	::std::string s2 = "ATTTATTTTTTATATGCGGCCG";
    	appendValue(rows(ali), s1);
    	appendValue(rows(ali), s2);
    	::std::cout << "Score = " << localAlignment(ali,
Score<int>(3,-3,-2, -2), SmithWaterman()) << ::std::endl;
    	::std::cout << ali;
    	::std::cout << "Aligns Seq1[" << clippedBeginPosition(row(ali,
0)) << ":" << (clippedEndPosition(row(ali, 0))-1) << "]";
    	::std::cout << " and Seq2[" << clippedBeginPosition(row(ali, 1))
<< ":" <<  (clippedEndPosition(row(ali, 1))-1) << "]" << ::std::endl
<< ::std::endl;
    	return 0;
    }

I'd like to get the the information when I do `::std::cout << ali;` as
some kind of object that I can use without parsing the output.

Thanks!

Best,
Tianyang