Re: [Seqan-dev] Memory allocation error with globalAlignmentScore() and globalAlignment()

[Johannes Dröge <johdro@mpi-inf.mpg.de>]

Hi Manuel,

I replaced seqan::MyersHirschberg() with seqan::MyersBitVector() in the below code and it seems to work just fine. For this reason I believe it is a bug in the alignment code, a regression certainly.

Is the score the number of gaps and mismatches in the alignment (edit distance), when used like this? I just need this number but also it would be good to have the number of matches. When I have the length of the alignment, I can calculate this quantity by using (alignment_length+score) because score is given as a negative integer. How can I do this with globalAlignmentScore()?

Gruß Johannes


Am 21.08.2013 13:48, schrieb Holtgrewe, Manuel:
> Hi Johannes,
>
> we will investigate this problem.
>
> Meanwhile, you could use the globalAlignment() function without a tag. We do not have current benchmarks for MyerHirschberg vs. our new NeedlemanWunsch implementation but the latter is definitely more used and then less error prone.
>
> HTH
> Manuel
> ________________________________________
> From: Johannes Dröge [johdro@mpi-inf.mpg.de]
> Sent: Wednesday, August 21, 2013 12:54 PM
> To: SeqAn Development
> Subject: [Seqan-dev] Memory allocation error with globalAlignmentScore() and    globalAlignment()
>
> Hello Seqan developers,
>
> I just ported my software, which was using globalAlignment() extensively without problems, from a Seqan version from 2011 to the recent headers. I had to change the syntax related to the scoring until it compiled well. Anyway, now I got a segfault when running globalAlignment(). I then changed the code to use globalAlignmentsScore(), because I don't actually need the explicit alignment. The error is still persists and seems to be related to the data/types or similar.
>
> 1) Here is the original code fragment:
>
> const seqan::Dna5String qseq = ...
> seqan::Dna5String rseq = ...
> seqan::Align< seqan::Dna5String > aln;
> seqan::resize( seqan::rows( aln ), 2);
> seqan::assignSource( seqan::row( aln, 0 ), qseq );
> seqan::assignSource( seqan::row( aln, 1 ), rseq );
> const int score = -seqan::globalAlignment( aln, seqan::SimpleScore(), seqan::MyersHirschberg() );
>
> 2) Here is the intermediate code:
>
> const seqan::Dna5String qseq = ...
> seqan::Dna5String rseq = ...
> seqan::Align< seqan::Dna5String > aln;
> seqan::resize( seqan::rows( aln ), 2);
> seqan::assignSource( seqan::row( aln, 0 ), qseq );
> seqan::assignSource( seqan::row( aln, 1 ), rseq );
> const int score = -seqan::globalAlignment( aln, seqan::MyersHirschberg() );
>
> 3) Here is the current code:
>
> const seqan::Dna5String qseq = ...
> seqan::Dna5String rseq = ...
> const int score = -seqan::globalAlignmentScore( qseq, rseq, seqan::MyersHirschberg() );
>
> ----------
>
> This is what I get from (2) and (3):
>
> aligning two sequences globally:
> seq1: TAGCACTCAGGGAGAATGAGTGCTAAAACATAGAATGAGAAATGGAGGCGAGAGTATGGAGCTGACCAATCGAAAAAAGCGAATCCTGCGGGCCATTGTTGAGATCTATATCTCCACCGCGGAACCGGTAGGTTCCAAGGCCGTGGCAGAGCAGGCCGGACTGGACATCTCCACCGCCACCATACGAAATGAGATGGCCGACCTCACCGAACTGGGCTATCTGGAGCAGCCCCACACCTCGGCCGGACGGATTCCGTCCCCCATGGGCTACCGGCTCTACGTCAACGAGCTCATGGGTGAGCACCAGCTGACCATGCAGGAGACCCAGCGCATCAACGACGCGCTGAACCTGAAAATGGAGGAGCTGGACCGGGTCATCGACCGGGCGGGCAAGGTGCTCTCCCAGATCAGCGACTACCCCGTCTTTACCATGGCCCAGCCCAAGCAGCGGGTGACGGTAAAGCGGTACGACCTGCTGATGGTAGAGGAAAACGCCTTTATCGCTGTGGTGATGACCGACAACTCGGTGGTGCGCAACAAGCTTATCCACCTGTCCGATGAGCTTTCCGACACCCAGCTGCAGCTGCTGTCCACCGTTTTGAACAGCTCCTTTGTAGGTCTGACCGTGGAGGAAATGGAACAG
> seq2: TATATTAGCACTCGGAAAGCGAGAGTGCCAACAGTCCGAAGCGGAGAGTGCTAACATGGCAATCAGTGAGAGGAAAAAGAAAATACTGGCGGCGGTGGTGGATGAATACATCCGCACGGCAGAGCCGGTAGGCAGCAAGGCCATCGCCCAGAGCGGCGGGCTGAACTGCTCCTCGGCCACCATCCGCAACGAGCTGGCGGAGCTGGTCGCCATGGGCTATCTGGAGCAGCCCCACACCTCTGCGGGCCGGGTGCCCACCCCCATGGGCTACCGCATGTACGTCAACGAGCTCATGGAGAAGCAGAAGATGAGCCTGGAGGAGACGGAGGAGATGAACCGCCGCCTGAACCAGAAGCTCCAGGAGCTGGACGACACCATCCGGGACGTGAGCAAGCTGGCTTCCCAGCTGACGAATTATCCCGCCCTGGCCCTGACGGCCCAGAGCTCCGTCACGGTAAAGCGCTTCGACCTGATCTATGTGGACGCCAACAACTTCATCATCGTGCTGATGCTGTCCAACAACAGCGTAAAGAGCAAGCTGGTGCATCTGCCGGTGTCCGTGGACCAGGACATGATCAAGCGCCTTTCCACCCTCTTCAACGCCAGCTTTACCGGCGTGGAGGATCAGCAGATCACGCCG
> prog: malloc.c:4631: _int_malloc: Assertion `(unsigned long)(size) >= (unsigned long)(nb)' failed.
>
> ----------
>
> GDB backtrace:
>
> 0x00007ffff6a7d1b5 in raise () from /lib/libc.so.6
> (gdb) bt
> #0  0x00007ffff6a7d1b5 in raise () from /lib/libc.so.6
> #1  0x00007ffff6a7ffc0 in abort () from /lib/libc.so.6
> #2  0x00007ffff6ab35bb in ?? () from /lib/libc.so.6
> #3  0x00007ffff6abce16 in ?? () from /lib/libc.so.6
> #4  0x00000000004f13ce in seqan::deallocate<seqan::String<unsigned int, seqan::Alloc<void> >, unsigned int, unsigned long, seqan::AllocateStorage_> (data=0x832831460)
>       at seqan/basic/allocator_interface.h:329
> #5  0x00000000004ecc09 in seqan::_deallocateStorage<unsigned int, void, unsigned int, unsigned long> (me=..., ptr=0x832831460, capacity=32)
>       at seqan/sequence/string_alloc.h:402
> #6  0x00000000004e76d6 in ~String (this=0x7fffede12e80, __in_chrg=<value optimized out>)
>       at seqan/sequence/string_alloc.h:177
> #7  0x00000000004e1ebd in seqan::_globalAlignment<seqan::String<seqan::SimpleType<unsigned char, seqan::Dna5_>, seqan::Alloc<void> >, seqan::Tag<seqan::ArrayGaps_>, seqan::String<seqan::SimpleType<unsigned char, seqan::Dna5_>, seqan::Alloc<void> >, seqan::Tag<seqan::ArrayGaps_> > (gapsH=..., gapsV=..., algorithmTag=...)
>       at seqan/align/global_alignment_myers_hirschberg_impl.h:745
> #8  0x00000000004df9ea in seqan::_globalAlignment<seqan::String<seqan::SimpleType<unsigned char, seqan::Dna5_>, seqan::Alloc<void> >, seqan::Tag<seqan::ArrayGaps_>, seqan::String<seqan::SimpleType<unsigned char, seqan::Dna5_>, seqan::Alloc<void> >, seqan::Tag<seqan::ArrayGaps_> > (gapsH=..., gapsV=..., algorithmTag=...)
>       at seqan/align/global_alignment_myers_hirschberg_impl.h:183
> #9  0x00000000004db18c in seqan::globalAlignment<seqan::String<seqan::SimpleType<unsigned char, seqan::Dna5_>, seqan::Alloc<void> >, seqan::Tag<seqan::ArrayGaps_> > (align=...,
>       algorithmTag=...) at seqan/align/global_alignment_specialized.h:93
> #...
>
> Could this be related to the differing sequence lengths or am I doing something else wrong?
>
> Gruß Johannes
>
> _______________________________________________
> seqan-dev mailing list
> seqan-dev@lists.fu-berlin.de
> https://lists.fu-berlin.de/listinfo/seqan-dev
>
> _______________________________________________
> seqan-dev mailing list
> seqan-dev@lists.fu-berlin.de
> https://lists.fu-berlin.de/listinfo/seqan-dev