Re: [Seqan-dev] SAM issue?

[Manuel Holtgrewe <manuel.holtgrewe@fu-berlin.de>]

OK, there was another gotcha, I guess :)

In the code, I took the sample from, the contig is actually in the  
fragment store. In your case, you have to use "Nothing" for the contig  
sequence. See the attached and now hopefully fixed file.

Am 21.03.2011 um 14:29 schrieb Mat:

> Yes Manuel, you are right. This assumption was only valid with the  
> sorting of the store via:
> //sortAlignedReads(fragStore.alignedReadStore, SortId());
>
> which should be uncommented i guess.
>
> Sorry - but still i am not getting consistent results (but i have  
> the feeling i am getting closer at least;-) ). So if i use the  
> function positionGapToSeq i should get always the SAM coordinates,  
> not gap space right? I created a mini-sam file containing the two  
> lines:
>
> illumina_80bp_3kb.000000571    99    contig00002    19626    60     
> 80M    =    22401    2855          
> TGAAAACTGGGTAGAATTTCTGTTCGTTCCAAAAATGTCTCTCTACGTGGCAGCTGATGGTACTCTGGAGACACATGTCA 
>     HHHIHHHHHHGIGHGIJHIJJIIJKIGEQFHEHDJGEDMMBHKBFMIHEIJGLEEFIJKFID@A? 
> LLHKEMLIDBLGBGG    XT:A:U    NM:i:2    SM:i:37    AM:i:37    X0:i: 
> 1    X1:i:0    XM:i:2    XO:i:0    XG:i:0    MD:Z:29G32T17
> illumina_80bp_3kb.000000571    147    contig00002    22401    60     
> 80M    =    19626    -2855     
> GTGTTTATGTTTAAAAAAAATTTCAAACCAGATTGAGATGCAATCTTTCAAATGAGGGTAACAGTAAATATATATGTAGT 
>            
> HIHIIHHHIIIGGGIIIFIIHGHLIHOFLFHKKIKHJHILFMMNLGFDLMFPHIEGPHOLJHJHKGII 
> @HHNPDIIAQTD    XT:A:U    NM:i:0    SM:i:37    AM:i:37    X0:i:1     
> X1:i:0    XM:i:0    XO:i:0    XG:i:0    MD:Z:80
>
> Then i get (by using your code):
>
> illumina_80bp_3kb.000000571
> 0,0
>
> if i use it on sam files of different size it varies between 0,0  
> (smaller files) and the correct coordinates (big files)...
>
> cheers
>
> mat
>
>
> Am 3/21/11 1:12 PM, schrieb Holtgrewe, Manuel:
> > Your problem is that you use an alignment id as the read id. See my  
> > proposal for a fixed version attached that yields consistent  
> > results for me (regarding the positions, there still is the bug  
> > using alignment ids for read ids so the printed read names are  
> > wrong).
> >
> > $ ./demos/SAMtest -s bug2.sam
> > Loading SAM file bug2.sam
> > Reads cached...
> > n:2825 id: 1022
> > illumina_80bp_3kb.000000199
> > 19625,19705
> >
> > $ ./demos/SAMtest -s bug3.sam
> > Loading SAM file bug3.sam
> > Reads cached...
> > n:3253 id: 1022
> > illumina_80bp_3kb.000000170
> > 19625,19705
> >
> > $ ./demos/SAMtest -s bug4.sam
> > Loading SAM file bug4.sam
> > Reads cached...
> > n:3648 id: 1022
> > illumina_80bp_3kb.000000148
> > 19625,19705
> >
> >
> > Am 21.03.2011 um 12:52 schrieb Mat:
> >
> > > Hi!
> > >
> > > So if i adapt the code i still get the weired results:
> > >
> > > test.sam:
> > >
> > > illumina_80bp_3kb.000000571
> > > 2128,2048
> > >
> > >
> > > bug2.sam (70000 lines of test.sam):
> > >
> > > illumina_80bp_3kb.000000571
> > > 237,157
> > >
> > > (code attached...)
> > >
> > > cheers
> > > <SAMtest.cpp><ATT00001..txt>
> > >
> > > _______________________________________________
> > > seqan-dev mailing list
> > > seqan-dev@lists.fu-berlin.de
> > > https://lists.fu-berlin.de/listinfo/seqan-dev
> <mini.sam><ATT00001..txt>

--
Manuel Holtgrewe			manuel.holtgrewe@fu-berlin.de
Freie Universität Berlin		http://www.inf.fu-berlin.de/
Institut für Informatik			Phone: +49 30 838 75246
Takustraße 9				Algorithmic Bioinformatics
14195 Berlin				Room 021

Attachment: SAMtest.cpp
Description: Binary data