Re: [Seqan-dev] How to extract alignment information from an Align object when doing a Smith-Waterman alignment?

[Tianyang Li 李天阳 Tommy Li <tmy1018@gmail.com>]

Hi Birte,

I actually want to turn the alignment result into something similar to
a CIGAR string in SAM.

I've read the tutorial and I hope that I can get something more than
`clippedBeginPosition` and `clippedEndPosition`.

Should I treat each row as an ArrayGaps?

Best,
Tianyang

On Wed, Aug 1, 2012 at 10:02 PM, Kehr, Birte <Birte.Kehr@fu-berlin.de> wrote:
> Hi Tianyang,
>
> what kind of alignment information are you looking for? You can iterate the Align object (or the rows of the Align object) to extract information about the position of gaps.
>
> You might have found it yourself already but if not, the Alignments tutorial gives a good introduction to the Align data structure:
> http://trac.seqan.de/wiki/Tutorial/Alignments
>
>
> Birte
>
>
>
> -----Original Message-----
> From: Tianyang Li 李天阳 Tommy Li [mailto:tmy1018@gmail.com]
> Sent: Mittwoch, 1. August 2012 15:48
> To: SeqAn Development
> Subject: [Seqan-dev] How to extract alignment information from an Align object when doing a Smith-Waterman alignment?
>
> Hi,
>
> I have a question about how to extract alignment information from an Align object when doing Smith-Waterman alignment.
>
> For example,
>
>     #include <iostream>
>     #include <seqan/align.h>
>     #include <string>
>
>     using namespace seqan;
>
>     int main()
>     {
>         Align< String<Dna> > ali;
>         ::std::string s1 = "CGCGGGGCATATATTTTTTTA";
>         ::std::string s2 = "ATTTATTTTTTATATGCGGCCG";
>         appendValue(rows(ali), s1);
>         appendValue(rows(ali), s2);
>         ::std::cout << "Score = " << localAlignment(ali, Score<int>(3,-3,-2, -2), SmithWaterman()) << ::std::endl;
>         ::std::cout << ali;
>         ::std::cout << "Aligns Seq1[" << clippedBeginPosition(row(ali,
> 0)) << ":" << (clippedEndPosition(row(ali, 0))-1) << "]";
>         ::std::cout << " and Seq2[" << clippedBeginPosition(row(ali, 1)) << ":" <<  (clippedEndPosition(row(ali, 1))-1) << "]" << ::std::endl << ::std::endl;
>         return 0;
>     }
>
> I'd like to get the the information when I do `::std::cout << ali;` as some kind of object that I can use without parsing the output.
>
> Thanks!
>
> Best,
> Tianyang
>
> _______________________________________________
> seqan-dev mailing list
> seqan-dev@lists.fu-berlin.de
> https://lists.fu-berlin.de/listinfo/seqan-dev
> _______________________________________________
> seqan-dev mailing list
> seqan-dev@lists.fu-berlin.de
> https://lists.fu-berlin.de/listinfo/seqan-dev