--Hi,is anyone able to fix the bug in the FAR software developed by Matthias Dodt FAR?
thank you -- Hi Laurent! Sorry for the delay in reply. Yes you are right, there is a bug in the software. Unfortunately i cannot fix this at the moment since i have moved out of sience several month ago. I contacted my group but currently there seems to be nobody taking care of this. I think it will be fixed in the future, but i can't tell you when. I will get back to you if i have further information. thanks, mat 2012/1/6 laurent manchon<lmanchon@users.sourceforge.net>:
--hello, i have some problem to clean my sequences using this adaptor string: AATCTCGTATGCCGTCTTCTGCTTGC this is my input file:sequence_100104ATAGTCAACGGCTGAGGATTTGGCATCTCGTAsequence_100105ATAGTCAAGATAGAGCTACTGGAGAATCTCGAsequence_100106ATAGTCAAGATAGAGCTACTGGAGAATCTCGTsequence_100107ATAGTCAAGATAGAGCTACTGGGGAATCTCGT i use this command to clean: far --source reads.fa --target reads_no_adapters.fa --adapters myAdapters.fa --format fasta --cut-off 4 --min-overlap 2 --min-readlength 16 --trim-end right and this is the output:sequence_100104ATAGTCAACGGCTGAGGATTTGGCATCTCGTAsequence_100105ATAGTCAAGATAGAGCTACTGGAGAATCTCGAsequence_100106ATAGTCAAGATAGAGCTACTGGAGsequence_100107ATAGTCAAGATAGAGCTACTGGGG So, sequence_100106 and sequence_100107 are well cleaned but not sequence_100104, the good results should be:sequence_100104ATAGTCAACGGCTGAGGATTTGGCsequence_100105ATAGTCAAGATAGAGCTACTGGAGAATCTCGAsequence_100106ATAGTCAAGATAGAGCTACTGGAGsequence_100107ATAGTCAAGATAGAGCTACTGGGG substring \"ATCTCGTA\" is a part of adaptor sequence ! Somebody has a solution to resolve this problem ? thank you. -- This message was sent to your SourceForge.net email alias via the web mail form. You may reply to this message directly, or via https://sourceforge.net/sendmessage.php?touser=2041456 To update your email alias preferences, please visit https://sourceforge.net/account